Instructions
Your PCR primers have arrived and you head into the lab to clone your gene. The primers you have designed should amplify your 1kb target gene and thankfully Prof. E. M. Eritus has sent you the gene already cloned into a plasmid. Unfortunately, Prof. E. M. Eritus is a little Old School, and there are no standard assembly methods flanking the gene for you to take advantage of. You have therefore included the relevant restriction sites for downstream cloning in the primers, and, whilst waiting for your primers, you have prepared Prof. Eritus' plasmid. All you need to do is amplify it, move it into your favourite expression vector and you can move on to some real work.
You have access to two polymerases in the lab. The standard NEB Taq polymerase, and Phusion polymerase. Each comes with its own buffer, and slightly different instructions for running the PCR. Your primer sequences are as follows:
Primers to amplify 1kb fragment from a 5 kb plasmid.
| Primer name | Primer Sequence |
|---|---|
| FWD1 | GCAACGTGCTGGTTATTGTG |
| REV1 | AGCGGATAACAATTTCACACAGG |
You have prepared your stock solutions as normal, and are ready to go. Using the virtual PCR simulator, you set the volumes of the various reagents, set your PCR conditions and clone that gene! Remember you want to maximise yield and purity.
Got it!